PROTEOMICS101.com 

News, * Jobs *, Resources

Research, Information, BioTech  

 

  Exact Time

 

  Like us:    Follow us:  

* NEW Google Search:

    

Custom Search

* NEW Ebay Search:


 

    * Latest "Human-Genome" in the News * 

 

 

     Live EBAY Auctions 

The Human Genome
$3.99
End Date: Saturday Jan-20-2018 12:27:29 PST
Buy It Now for only: $3.99
Buy It Now | Add to watch list

Life Script: How the Human Genome Discoveries Will Transform Medicine and Enhanc
$14.19
End Date: Tuesday Feb-6-2018 18:44:45 PST
Buy It Now for only: $14.19
Buy It Now | Add to watch list

Guide to Human Genome Computing by M.J. Bishop Hardcover Book (English)
$216.06
End Date: Monday Jan-29-2018 17:06:00 PST
Buy It Now for only: $216.06
Buy It Now | Add to watch list

The Human Genome: Biology and Medicine (English) Paperback Book
$130.30
End Date: Thursday Jan-25-2018 11:54:48 PST
Buy It Now for only: $130.30
Buy It Now | Add to watch list

How the Human Genome Works (Paperback or Softback)
$57.64
End Date: Sunday Feb-4-2018 20:11:22 PST
Buy It Now for only: $57.64
Buy It Now | Add to watch list

THE HUMAN GENOME - RICHARDS, JULIA E./ HAWLEY, R. SCOTT - NEW PAPERBACK BOOK
$89.87
End Date: Wednesday Feb-14-2018 15:11:51 PST
Buy It Now for only: $89.87
Buy It Now | Add to watch list

HUMAN GENOME RESEARCH AND THE CHALLENGE OF CONTINGENT FUTURE PERSONS - NEW PAPER
$30.41
End Date: Wednesday Jan-31-2018 12:34:52 PST
Buy It Now for only: $30.41
Buy It Now | Add to watch list

HUMAN GENOME EDITING - COMMITTEE ON HUMAN GENE EDITING (COR) - NEW BOOK
$72.85
End Date: Tuesday Jan-30-2018 12:29:49 PST
Buy It Now for only: $72.85
Buy It Now | Add to watch list

The Human Genome Diversity Project: An Ethnography of Scientific Practice by Ama
$139.78
End Date: Wednesday Jan-31-2018 17:52:37 PST
Buy It Now for only: $139.78
Buy It Now | Add to watch list

The Human Genome Project: Cracking the Genetic Code of Life by Thomas F. Lee (En
$136.41
End Date: Friday Feb-9-2018 20:58:58 PST
Buy It Now for only: $136.41
Buy It Now | Add to watch list

Biotechnology and the Human Genome: Innovations and Impact (English) Paperback B
$130.30
End Date: Wednesday Feb-14-2018 14:39:35 PST
Buy It Now for only: $130.30
Buy It Now | Add to watch list

THE HUMAN GENOME DIVERSITY PROJECT - NEW PAPERBACK BOOK
$60.21
End Date: Wednesday Feb-14-2018 15:06:51 PST
Buy It Now for only: $60.21
Buy It Now | Add to watch list

     Internet Search Results 

National Human Genome Research Institute (NHGRI)
The National Human Genome Research Institute conducts genetic and genomic research, funds genetic and genomic research and promotes that research to advance genomics ...

All About The Human Genome Project (HGP) - National Human ...
Introduction to the Human Genome Project, published by the National Human Genome Research Institute. This brief overview is aimed at students, teachers and other non ...

http://www.ensembl.org/Homo_sapiens/Info/Index
We would like to show you a description here but the site won’t allow us.

Genomics.energy.gov--genome programs of the U.S ...
Site of the U.S. Human Genome Project, Genomic Science Program, and Microbial Genome Program; all sponsored by the U.S. Department of Energy Genome Programs.

Human Genome: First 1000 lines of Chromosome 1
human genome: first 1000 lines of chromosome 1 gatcaatgaggtggacaccagaggcggggacttgtaaataacactgggctgtaggagtga ...

Describing sequence variants - HGVS
Society information Membership Databases & tools Guidelines & recommendations Meetings Contact us . NOTE: this website is frozen ...

UCSC Genome Browser Home
Provides genome browser, gene sorter, blat search function, and publications.

The Human Genome Project
The Human Genome Project, Part 1 What is the Human Genome Project? What is The Human Genome Project (HGP)? What are the overall goals of the HGP?

RACE - Race and Human Variation
© 2016 American Anthropological Association. All rights reserved.

Human Genome Variation Society
The Society aims to foster discovery and characterization of genomic variations including population distribution and phenotypic associations.

PROTEOMICS101.COM --- Proteomics Information, News, and Resources, Lots More
Need to Find information on any subject? ASK THE PROTEOMICS101 GURU!

 * Contact us:  support@z101.com
 
                                  

Copyright � 2007- 2018  PROTEOMICS101.COM